ID: 917846874_917846882

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 917846874 917846882
Species Human (GRCh38) Human (GRCh38)
Location 1:179026585-179026607 1:179026605-179026627
Sequence CCGGGAAGCGCGAGTGACCTGCA GCAGGCCGGAGGCGGAAGGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 79} {0: 1, 1: 0, 2: 2, 3: 55, 4: 443}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!