ID: 917895985_917895988

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 917895985 917895988
Species Human (GRCh38) Human (GRCh38)
Location 1:179487716-179487738 1:179487742-179487764
Sequence CCAGGCGTGATGGCTCATGCCTG CTCGACACTTTGTAAGGCCAAGG
Strand - +
Off-target summary {0: 206, 1: 7388, 2: 47444, 3: 131710, 4: 192178} {0: 1, 1: 1, 2: 74, 3: 2802, 4: 21850}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!