ID: 917895986_917895996

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 917895986 917895996
Species Human (GRCh38) Human (GRCh38)
Location 1:179487735-179487757 1:179487784-179487806
Sequence CCTGTAACTCGACACTTTGTAAG CCAGGAATTTAAGACCAACCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 209} {0: 2, 1: 391, 2: 7751, 3: 60287, 4: 183456}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!