|
Left Crispr |
Right Crispr |
Crispr ID |
917908199 |
917908206 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
1:179611171-179611193
|
1:179611201-179611223
|
Sequence |
CCATCCAAGTAGCTGGAATTACA |
CCACCATACTTGGCTAATTTTGG |
Strand |
- |
+ |
Off-target summary |
{0: 111, 1: 5418, 2: 64216, 3: 162909, 4: 278199} |
{0: 2, 1: 23, 2: 387, 3: 785, 4: 1220} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|