ID: 917908199_917908206

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 917908199 917908206
Species Human (GRCh38) Human (GRCh38)
Location 1:179611171-179611193 1:179611201-179611223
Sequence CCATCCAAGTAGCTGGAATTACA CCACCATACTTGGCTAATTTTGG
Strand - +
Off-target summary {0: 111, 1: 5418, 2: 64216, 3: 162909, 4: 278199} {0: 2, 1: 23, 2: 387, 3: 785, 4: 1220}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!