ID: 917922252_917922258

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 917922252 917922258
Species Human (GRCh38) Human (GRCh38)
Location 1:179760294-179760316 1:179760307-179760329
Sequence CCCATTGTATGCCCAATGTGTAA CAATGTGTAAGGCTGACCCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 122} {0: 1, 1: 0, 2: 3, 3: 4, 4: 102}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!