ID: 917962373_917962386

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 917962373 917962386
Species Human (GRCh38) Human (GRCh38)
Location 1:180155110-180155132 1:180155163-180155185
Sequence CCTGGTGCGGCCACTGCATCGCC GACGTCAAAGGTGAGAAGCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 96} {0: 1, 1: 0, 2: 0, 3: 3, 4: 88}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!