ID: 918042535_918042542

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 918042535 918042542
Species Human (GRCh38) Human (GRCh38)
Location 1:180921951-180921973 1:180921992-180922014
Sequence CCGGTAACCTAGCGCAAGTGAAA CACAGCAATCAGGGCAACGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 35} {0: 1, 1: 0, 2: 0, 3: 6, 4: 122}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!