ID: 918064220_918064228

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 918064220 918064228
Species Human (GRCh38) Human (GRCh38)
Location 1:181088869-181088891 1:181088884-181088906
Sequence CCCCGGCGCCGACGGCCCTGTGC CCCTGTGCAGGGGAAGCAGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 101} {0: 1, 1: 1, 2: 3, 3: 43, 4: 437}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!