ID: 918108594_918108596

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 918108594 918108596
Species Human (GRCh38) Human (GRCh38)
Location 1:181435171-181435193 1:181435191-181435213
Sequence CCCTAGAGAGCTAGTTGTTAAAT AATGTTTACCAGCACACCACTGG
Strand - +
Off-target summary {0: 1, 1: 5, 2: 21, 3: 115, 4: 443} {0: 3, 1: 13, 2: 40, 3: 127, 4: 305}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!