ID: 918115396_918115412

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 918115396 918115412
Species Human (GRCh38) Human (GRCh38)
Location 1:181491919-181491941 1:181491963-181491985
Sequence CCAGGACCTGTAAGACCAGGTGT GGTTGCCAGGAGGTGGTGTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 114} {0: 1, 1: 0, 2: 12, 3: 137, 4: 852}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!