ID: 918198294_918198299

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 918198294 918198299
Species Human (GRCh38) Human (GRCh38)
Location 1:182243127-182243149 1:182243178-182243200
Sequence CCTCTGCTCATATCTTCACAGAT CCCACAGAGTCTGCCAGCACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 219} {0: 1, 1: 0, 2: 0, 3: 14, 4: 185}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!