ID: 918231214_918231216

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 918231214 918231216
Species Human (GRCh38) Human (GRCh38)
Location 1:182534316-182534338 1:182534350-182534372
Sequence CCTGGTAAATGAAAAATAATGTG ATTCTTATTTATACTTCTTTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 36, 4: 377} {0: 1, 1: 0, 2: 6, 3: 75, 4: 1032}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!