ID: 918240543_918240551

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 918240543 918240551
Species Human (GRCh38) Human (GRCh38)
Location 1:182616440-182616462 1:182616463-182616485
Sequence CCAGTGCTGCTGAGCATACAGAC CTGAGCACAGCGGAGGGGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 237} {0: 1, 1: 0, 2: 2, 3: 45, 4: 429}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!