ID: 918357884_918357892

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 918357884 918357892
Species Human (GRCh38) Human (GRCh38)
Location 1:183723460-183723482 1:183723505-183723527
Sequence CCCTGGCAGTGGCCGCATAGCAA AGGGAGAGTACAGTGACTGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 93} {0: 1, 1: 20, 2: 107, 3: 191, 4: 439}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!