ID: 918471910_918471921

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 918471910 918471921
Species Human (GRCh38) Human (GRCh38)
Location 1:184884061-184884083 1:184884095-184884117
Sequence CCCCCAACTTGCAGCCAGATAAC CTGCTTCACCGGGGCCTCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 110} {0: 1, 1: 0, 2: 3, 3: 24, 4: 217}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!