ID: 918478566_918478578

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 918478566 918478578
Species Human (GRCh38) Human (GRCh38)
Location 1:184952434-184952456 1:184952481-184952503
Sequence CCATGACGTTTGAGGTTTTAAGG TGGGATTCCCCGGGCCACATTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 5, 4: 103} {0: 1, 1: 1, 2: 17, 3: 529, 4: 1114}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!