ID: 918487554_918487560

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 918487554 918487560
Species Human (GRCh38) Human (GRCh38)
Location 1:185045581-185045603 1:185045611-185045633
Sequence CCGCGGCAGCTGATACCAGAGTC GGCCGCGGCCAGCGGAGCCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 117} {0: 1, 1: 0, 2: 5, 3: 42, 4: 387}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!