ID: 918575533_918575543

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 918575533 918575543
Species Human (GRCh38) Human (GRCh38)
Location 1:186054763-186054785 1:186054816-186054838
Sequence CCTCCTTCATGGTCTCAAGATGG GAAGGCAAGAGTAAGGGAAAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 33, 4: 213} {0: 1, 1: 0, 2: 13, 3: 150, 4: 1215}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!