ID: 918579164_918579165

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 918579164 918579165
Species Human (GRCh38) Human (GRCh38)
Location 1:186105007-186105029 1:186105046-186105068
Sequence CCATTACTGTAGGTCTTAAAGGC GTTATAAGAAAACAAGATGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 84} {0: 1, 1: 0, 2: 4, 3: 90, 4: 692}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!