ID: 918584612_918584615

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 918584612 918584615
Species Human (GRCh38) Human (GRCh38)
Location 1:186171401-186171423 1:186171428-186171450
Sequence CCATTGTGGATGTGAACCTGGGT GCTCAAAGGCAGAAAATGCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 223} {0: 1, 1: 0, 2: 3, 3: 37, 4: 319}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!