ID: 918647189_918647200

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 918647189 918647200
Species Human (GRCh38) Human (GRCh38)
Location 1:186918346-186918368 1:186918387-186918409
Sequence CCCCCAGAGTTTAACAGGCCCTT ATGCACTTGGAGGGTTAGAGAGG
Strand - +
Off-target summary {0: 8, 1: 9, 2: 41, 3: 41, 4: 101} {0: 1, 1: 7, 2: 16, 3: 38, 4: 160}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!