ID: 918976107_918976113

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 918976107 918976113
Species Human (GRCh38) Human (GRCh38)
Location 1:191488593-191488615 1:191488628-191488650
Sequence CCTCCTACCTCATTCACACACAC CAATATACAATTGTGGAGCTGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!