ID: 919001563_919001566

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 919001563 919001566
Species Human (GRCh38) Human (GRCh38)
Location 1:191838340-191838362 1:191838353-191838375
Sequence CCCCAGACACTAAATCTGATGGT ATCTGATGGTGCCTTGATTTTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 13, 3: 52, 4: 222} {0: 2, 1: 22, 2: 270, 3: 764, 4: 1650}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!