ID: 919254899_919254903

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 919254899 919254903
Species Human (GRCh38) Human (GRCh38)
Location 1:195108490-195108512 1:195108527-195108549
Sequence CCCACTCAAAACCGCTCAACTAC ACCTGCTGCTGAATGACTACTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!