ID: 919342000_919342002

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 919342000 919342002
Species Human (GRCh38) Human (GRCh38)
Location 1:196322373-196322395 1:196322414-196322436
Sequence CCAGGGAAGAATAAATATACATG AAACACAGGCTGAAACTAACCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 272} {0: 1, 1: 0, 2: 2, 3: 56, 4: 1014}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!