ID: 919416266_919416271

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 919416266 919416271
Species Human (GRCh38) Human (GRCh38)
Location 1:197314116-197314138 1:197314136-197314158
Sequence CCTGTTCTTTTTCTCCTCTCCCT CCTCTGGTACTGCAATTATATGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 16, 3: 205, 4: 1624} {0: 1, 1: 0, 2: 0, 3: 10, 4: 87}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!