ID: 919446148_919446154

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 919446148 919446154
Species Human (GRCh38) Human (GRCh38)
Location 1:197708074-197708096 1:197708125-197708147
Sequence CCTACGCCCACGGAATCGCGCTG CTGCAAGGCGGCAACGAGGCTGG
Strand - +
Off-target summary {0: 16, 1: 450, 2: 786, 3: 859, 4: 831} {0: 315, 1: 1152, 2: 1845, 3: 1595, 4: 741}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!