ID: 919713233_919713238

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 919713233 919713238
Species Human (GRCh38) Human (GRCh38)
Location 1:200749298-200749320 1:200749331-200749353
Sequence CCACAGCTGTAGCTTGCCACAAG GCCATGGGCATTGTGTTCCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 92} {0: 1, 1: 0, 2: 1, 3: 21, 4: 186}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!