ID: 919721317_919721327

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 919721317 919721327
Species Human (GRCh38) Human (GRCh38)
Location 1:200839647-200839669 1:200839695-200839717
Sequence CCATAAGGATGCAAAGGCATAAG CAGGGAAAAAAGCAGGAGGGAGG
Strand - +
Off-target summary {0: 1, 1: 28, 2: 39, 3: 48, 4: 162} {0: 1, 1: 0, 2: 7, 3: 103, 4: 950}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!