ID: 919748613_919748621

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 919748613 919748621
Species Human (GRCh38) Human (GRCh38)
Location 1:201023442-201023464 1:201023458-201023480
Sequence CCGAGGCAGCGGCTGCGGCTGCG GGCTGCGGGAGGCGGGGGCGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 82, 4: 611} {0: 1, 1: 1, 2: 23, 3: 210, 4: 1819}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!