ID: 919751341_919751357

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 919751341 919751357
Species Human (GRCh38) Human (GRCh38)
Location 1:201040060-201040082 1:201040099-201040121
Sequence CCCAGGCCCCCTCGAACCAGAGC AGGCTGAGTGGGGTCTTCCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 146} {0: 1, 1: 0, 2: 0, 3: 30, 4: 224}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!