ID: 919782151_919782156

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 919782151 919782156
Species Human (GRCh38) Human (GRCh38)
Location 1:201228125-201228147 1:201228156-201228178
Sequence CCACTCTCGAAACACCCCAGCTT ATGTAGTCCCGGAACGAAGATGG
Strand - +
Off-target summary {0: 1, 1: 5, 2: 5, 3: 13, 4: 112} {0: 1, 1: 0, 2: 0, 3: 2, 4: 37}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!