ID: 919807954_919807958

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 919807954 919807958
Species Human (GRCh38) Human (GRCh38)
Location 1:201391890-201391912 1:201391910-201391932
Sequence CCCTGCATTGTCTGCAAATCAGG AGGTTAAAAGGTTCTAGAAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 152} {0: 1, 1: 0, 2: 3, 3: 46, 4: 372}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!