ID: 919808587_919808598

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 919808587 919808598
Species Human (GRCh38) Human (GRCh38)
Location 1:201395471-201395493 1:201395520-201395542
Sequence CCACTGGGTGCGGTGGCTCATGC AAGGCGGCCGGATCACTTGAGGG
Strand - +
Off-target summary {0: 18, 1: 78, 2: 323, 3: 813, 4: 1155} {0: 1, 1: 5, 2: 84, 3: 376, 4: 923}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!