ID: 919851357_919851366

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 919851357 919851366
Species Human (GRCh38) Human (GRCh38)
Location 1:201675121-201675143 1:201675150-201675172
Sequence CCCCACCTCTGACCTGGGGATGA CACATGAGATTTAGAGGGAACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 49, 4: 440} {0: 1, 1: 0, 2: 6, 3: 34, 4: 314}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!