ID: 919896991_919897003

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 919896991 919897003
Species Human (GRCh38) Human (GRCh38)
Location 1:202015182-202015204 1:202015225-202015247
Sequence CCTCTGACCATCCTTCTCTTCAC GAGATCCTGGAACGGGTGGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 381} {0: 1, 1: 0, 2: 0, 3: 11, 4: 165}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!