ID: 919933636_919933644

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 919933636 919933644
Species Human (GRCh38) Human (GRCh38)
Location 1:202237222-202237244 1:202237240-202237262
Sequence CCCTCTCCTCTCCCTCCATCCAG TCCAGCCTCACCCCTGGACAGGG
Strand - +
Off-target summary {0: 1, 1: 5, 2: 33, 3: 196, 4: 1787} {0: 1, 1: 0, 2: 4, 3: 27, 4: 275}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!