ID: 919958092_919958100

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 919958092 919958100
Species Human (GRCh38) Human (GRCh38)
Location 1:202438888-202438910 1:202438916-202438938
Sequence CCATACATCCACCGCACGCGGCC CCTGGAGGTGACCCCGAAGACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 28} {0: 1, 1: 1, 2: 0, 3: 18, 4: 153}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!