ID: 919976277_919976283

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 919976277 919976283
Species Human (GRCh38) Human (GRCh38)
Location 1:202615126-202615148 1:202615148-202615170
Sequence CCACCAGAGGAAAATGACTTAGA AGCTGCAGAGAGGGAATGTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 172} {0: 3, 1: 0, 2: 2, 3: 37, 4: 526}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!