ID: 920041930_920041938

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 920041930 920041938
Species Human (GRCh38) Human (GRCh38)
Location 1:203103684-203103706 1:203103697-203103719
Sequence CCAAGCAAATCCTCAACCTCGTT CAACCTCGTTGGGGGTTGAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 94} {0: 1, 1: 0, 2: 0, 3: 3, 4: 100}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!