ID: 920044942_920044948

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 920044942 920044948
Species Human (GRCh38) Human (GRCh38)
Location 1:203127089-203127111 1:203127129-203127151
Sequence CCTTATGGCTTAGCGCTGTGCTA GAAGGAAAAGGAGCGCAGAGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 94} {0: 1, 1: 0, 2: 15, 3: 81, 4: 757}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!