ID: 920047502_920047515

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 920047502 920047515
Species Human (GRCh38) Human (GRCh38)
Location 1:203142921-203142943 1:203142969-203142991
Sequence CCGCAATGCCCTGTTCTCTGTAA GGTCCCCTGGGGCCATAACTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 283} {0: 1, 1: 0, 2: 0, 3: 6, 4: 109}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!