ID: 920076572_920076578

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 920076572 920076578
Species Human (GRCh38) Human (GRCh38)
Location 1:203341666-203341688 1:203341679-203341701
Sequence CCTCCAATCTGGTGGCTTTCCAG GGCTTTCCAGGGGTGAGGTTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 150} {0: 1, 1: 0, 2: 0, 3: 26, 4: 310}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!