ID: 920114289_920114299

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 920114289 920114299
Species Human (GRCh38) Human (GRCh38)
Location 1:203609120-203609142 1:203609158-203609180
Sequence CCACCACACCCGGCTAATTTTGC GGGGTTTCTCCATGTTGGTCAGG
Strand - +
Off-target summary {0: 43, 1: 2395, 2: 27169, 3: 122893, 4: 209105} {0: 12353, 1: 30279, 2: 108113, 3: 178545, 4: 183822}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!