ID: 920140609_920140614

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 920140609 920140614
Species Human (GRCh38) Human (GRCh38)
Location 1:203809419-203809441 1:203809432-203809454
Sequence CCCATCTCCGAAATCCCAGGTTG TCCCAGGTTGCTGGGATTACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 111} {0: 21, 1: 2841, 2: 71736, 3: 474689, 4: 496890}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!