ID: 920144284_920144293

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 920144284 920144293
Species Human (GRCh38) Human (GRCh38)
Location 1:203844827-203844849 1:203844848-203844870
Sequence CCCTCCTCCCTCCCCTTTTTCTG TGCTTGGTATTGTGAAAGCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 25, 3: 350, 4: 3006} {0: 1, 1: 0, 2: 1, 3: 5, 4: 143}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!