ID: 920172775_920172789

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 920172775 920172789
Species Human (GRCh38) Human (GRCh38)
Location 1:204082020-204082042 1:204082061-204082083
Sequence CCCTGCTGTTTCTCAGGCTTGCC CTGGTGGTGGGGTGTGTGTGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 7, 3: 44, 4: 389} {0: 1, 1: 1, 2: 23, 3: 152, 4: 1318}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!