ID: 920197428_920197433

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 920197428 920197433
Species Human (GRCh38) Human (GRCh38)
Location 1:204238363-204238385 1:204238402-204238424
Sequence CCCTGCCATCTTCTGCAGCTAAC GACACCTGTTGGTCTGTTACTGG
Strand - +
Off-target summary {0: 2, 1: 192, 2: 170, 3: 130, 4: 244} {0: 1, 1: 0, 2: 25, 3: 217, 4: 253}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!