ID: 920241608_920241612

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 920241608 920241612
Species Human (GRCh38) Human (GRCh38)
Location 1:204555989-204556011 1:204556034-204556056
Sequence CCTGTCAACAGTAGCAAATGTGG AGCATTTTAAAGTAACTTTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 92} {0: 1, 1: 1, 2: 9, 3: 61, 4: 705}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!