ID: 920260538_920260549

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 920260538 920260549
Species Human (GRCh38) Human (GRCh38)
Location 1:204685270-204685292 1:204685311-204685333
Sequence CCCCGGCGGCGGCGGCGCTGCCC CACACTCACCCCGTGGGCGCCGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 13, 3: 69, 4: 596} {0: 1, 1: 0, 2: 1, 3: 5, 4: 111}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!